How an epidemic (or pandemic) starts

Years ago Ebola made itself known to scientists, when it appeared simultaneously in the Sudan and Zaire. The two events were a very long way from each other. It happens that I am very familiar with that part of the map, and I’m certain that any attempt to go from Nzara, Sudan, to Yambuku Zaire on land would take several weeks and, actually, be impossible. It could not happen casually. For a while, experts thought a particular person who was probably patient zero at Yambuku had made the trip, despite no evidence for him having done so. In the end, most ebola experts simply stopped thinking about this conundrum. A few of us working in the area, though, had a different idea. Animal-born (we thought fruit bat) ebola spread in the animal first, and conditions emerged that heightened the chance of a jump to humans also spread, so there were two separate jumps. Likely, this could happen now and then, with several jumps within a few weeks time, but only during those few weeks time when conditions were just right. The trick to managing future ebola outbreaks might be to figure out what those conditions might be, and at least, set up a warning system. But, since epidemiology worked at the time entirely on the pump model, one source, one initial spread, that sort of thinking never happened.

If that is typical for zoonotic diseases (even if not inevitable in every case) it presents a slightly different view than what one usually conjures up. It is not the case that an animal sneezes or bleeds (or whatever) on a human, then that humna, patient zero spreads the disease to other humans. Rather, the condition of transfer from an animal reservoir becomes temporarily highly likely insead of almost impossible, and perhaps dozens of transfers happen, of which, one or two or three, perhaps, are traced to eventually by epidemiologists.

Turns out that is what probably happened with Covid-19. The transfer happened twice, over just a few weeks time. The best explanation for this is that some animal species (could be more than one) had their own epidemic of this particular coronavirus strain going on, and there happen to be a big market with this animal species (or species) on sale, and the rest is history.

There are two studies, this one and this one, seem to support this idea. When the disease experts are done being incredibly busy with Covid, maybe they can go back to Sudan/Congo and rethink the initial appearance of Ebola with this model, now no longer just some zany idea a few of us had years ago, in mind.

9 thoughts on “How an epidemic (or pandemic) starts

  1. Wow, thank you so much for this post, so quickly after those two papers appeared! Yet more, bigger, nails in the coffin of the lab leak speculation!

  2. Some less technical and brief explanations are in some videos by a couple of my favorite scientific debunkers. Each video’s textual description below the video has links to the sources of all the claims made in the videos.

    Dr. Dan Wilson:
    – video 1: https://youtu.be/qk3eHZLChRE
    – video 2: https://youtu.be/fmIo1XFxcEM

    potholer54:
    – video 1: https://youtu.be/ab-r0capbzk
    – video 2: https://youtu.be/aX1EqRuVeU0
    – video 3: https://youtu.be/PjafLCvejQA

  3. What about the patented dna sequence? One which doesn’t appear in nature but is a sign of human manipulation (patented sequence shows humans invented that portion of the virus). How does the double natural origin explain that part of the virus?

    1. Tom, rickA is famous for his lies and conspiracy theories, and his total lack of understanding of science. It isn’t that he needs to “keep up”, it’s that he needs to show some sign of wanting to learn and be an honest broker. His history shows he has no such desire.

  4. I guess I owe RickA an apology for claiming he does not keep up to date on downright stupid conspiracy theories. The “theory” he now is promoting indeed is an old one, but it has been resurrected in the crazy-sphere. So RickA is up to date, but not at all creative; he’s recycling other recycling. For a slightly technical explanation of the stupidity of this recycled lie, skip down to the section “Moderna and the ‘lab leak'” in https://sciencebasedmedicine.org/the-return-of-the-revenge-of-covid-19-mrna-vaccines-permanently-alter-your-dna-and-lab-leak/

  5. This genetic sequence is found in the SARS-2 virus: CAGACTAATTCTCCTCGGCGGGCACGTAGT
    It was patented in 2016 by Moderna. This sequence does not occur in nature.
    Not very likely it happened again randomly in nature 3 years later.

    However the Omicron variant appears to have evolved from a mouse.
    The mice caught Alpha? from humans, bounced around in the mice for a year, and then a human in South Africa caught it from a mouse. That human had a common cold and it seems to have mixed with the mouse virus.

Leave a Reply to RickA Cancel reply

Your email address will not be published. Required fields are marked *