<?xml version="1.0" encoding="UTF-8"?><rss version="2.0"
	xmlns:content="http://purl.org/rss/1.0/modules/content/"
	xmlns:dc="http://purl.org/dc/elements/1.1/"
	xmlns:atom="http://www.w3.org/2005/Atom"
	xmlns:sy="http://purl.org/rss/1.0/modules/syndication/"
	
	xmlns:georss="http://www.georss.org/georss"
	xmlns:geo="http://www.w3.org/2003/01/geo/wgs84_pos#"
	
	>
<channel>
	<title>
	Comments on: How an epidemic (or pandemic) starts	</title>
	<atom:link href="https://gregladen.com/blog/2022/02/26/how-an-epidemic-or-pandemic-starts/feed/" rel="self" type="application/rss+xml" />
	<link>https://gregladen.com/blog/2022/02/26/how-an-epidemic-or-pandemic-starts/</link>
	<description></description>
	<lastBuildDate>Sun, 13 Mar 2022 20:35:43 +0000</lastBuildDate>
	<sy:updatePeriod>
	hourly	</sy:updatePeriod>
	<sy:updateFrequency>
	1	</sy:updateFrequency>
	<generator>https://wordpress.org/?v=6.4.8</generator>
	<item>
		<title>
		By: JeffL		</title>
		<link>https://gregladen.com/blog/2022/02/26/how-an-epidemic-or-pandemic-starts/#comment-967759</link>

		<dc:creator><![CDATA[JeffL]]></dc:creator>
		<pubDate>Sun, 13 Mar 2022 20:35:43 +0000</pubDate>
		<guid isPermaLink="false">https://gregladen.com/blog/?p=34342#comment-967759</guid>

					<description><![CDATA[This genetic sequence is found in the SARS-2 virus:   CAGACTAATTCTCCTCGGCGGGCACGTAGT   
It was patented in 2016 by Moderna.   This sequence does not occur in nature.
Not very likely it happened again randomly in nature 3 years later.

However the Omicron variant appears to have evolved from a mouse.
The mice caught Alpha? from humans, bounced around in the mice for a year, and then a human in South Africa caught it from a mouse.   That human had a common cold and it seems to have mixed with the mouse virus.]]></description>
			<content:encoded><![CDATA[<p>This genetic sequence is found in the SARS-2 virus:   CAGACTAATTCTCCTCGGCGGGCACGTAGT<br />
It was patented in 2016 by Moderna.   This sequence does not occur in nature.<br />
Not very likely it happened again randomly in nature 3 years later.</p>
<p>However the Omicron variant appears to have evolved from a mouse.<br />
The mice caught Alpha? from humans, bounced around in the mice for a year, and then a human in South Africa caught it from a mouse.   That human had a common cold and it seems to have mixed with the mouse virus.</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		By: Lionel A		</title>
		<link>https://gregladen.com/blog/2022/02/26/how-an-epidemic-or-pandemic-starts/#comment-966195</link>

		<dc:creator><![CDATA[Lionel A]]></dc:creator>
		<pubDate>Wed, 02 Mar 2022 13:18:09 +0000</pubDate>
		<guid isPermaLink="false">https://gregladen.com/blog/?p=34342#comment-966195</guid>

					<description><![CDATA[&lt;blockquote&gt;The best explanation for this is that some animal species (could be more than one) had their own epidemic of this particular coronavirus strain going on, &lt;/blockquote&gt;

One of the points that Nathan Wolfe makes in his excellent book &#039;The Viral Storm&#039; which although published in 2012 is worth looking at today.

&lt;a href=&quot;https://www.theguardian.com/science/2012/nov/23/viral-storm-nathan-wolfe-review&quot; rel=&quot;nofollow ugc&quot;&gt;The Viral Storm by Nathan Wolfe – book review&lt;/a&gt;

and

&lt;a href=&quot;https://www.thelancet.com/journals/lancet/article/PIIS1473-3099(12)70045-2/fulltext&quot; rel=&quot;nofollow ugc&quot;&gt;The viral storm: the dawn of a new pandemic age&lt;/a&gt;]]></description>
			<content:encoded><![CDATA[<blockquote><p>The best explanation for this is that some animal species (could be more than one) had their own epidemic of this particular coronavirus strain going on, </p></blockquote>
<p>One of the points that Nathan Wolfe makes in his excellent book &#8216;The Viral Storm&#8217; which although published in 2012 is worth looking at today.</p>
<p><a href="https://www.theguardian.com/science/2012/nov/23/viral-storm-nathan-wolfe-review" rel="nofollow ugc">The Viral Storm by Nathan Wolfe – book review</a></p>
<p>and</p>
<p><a href="https://www.thelancet.com/journals/lancet/article/PIIS1473-3099(12)70045-2/fulltext" rel="nofollow ugc">The viral storm: the dawn of a new pandemic age</a></p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		By: Tom Dayton		</title>
		<link>https://gregladen.com/blog/2022/02/26/how-an-epidemic-or-pandemic-starts/#comment-965987</link>

		<dc:creator><![CDATA[Tom Dayton]]></dc:creator>
		<pubDate>Mon, 28 Feb 2022 14:29:58 +0000</pubDate>
		<guid isPermaLink="false">https://gregladen.com/blog/?p=34342#comment-965987</guid>

					<description><![CDATA[I guess I owe RickA an apology for claiming he does not keep up to date on downright stupid conspiracy theories. The &quot;theory&quot; he now is promoting indeed is an old one, but it has been resurrected in the crazy-sphere. So RickA is up to date, but not at all creative; he&#039;s recycling other recycling. For a slightly technical explanation of the stupidity of this recycled lie, skip down to the section &quot;Moderna and the &#039;lab leak&#039;&quot; in  https://sciencebasedmedicine.org/the-return-of-the-revenge-of-covid-19-mrna-vaccines-permanently-alter-your-dna-and-lab-leak/]]></description>
			<content:encoded><![CDATA[<p>I guess I owe RickA an apology for claiming he does not keep up to date on downright stupid conspiracy theories. The &#8220;theory&#8221; he now is promoting indeed is an old one, but it has been resurrected in the crazy-sphere. So RickA is up to date, but not at all creative; he&#8217;s recycling other recycling. For a slightly technical explanation of the stupidity of this recycled lie, skip down to the section &#8220;Moderna and the &#8216;lab leak'&#8221; in  <a href="https://sciencebasedmedicine.org/the-return-of-the-revenge-of-covid-19-mrna-vaccines-permanently-alter-your-dna-and-lab-leak/" rel="nofollow ugc">https://sciencebasedmedicine.org/the-return-of-the-revenge-of-covid-19-mrna-vaccines-permanently-alter-your-dna-and-lab-leak/</a></p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		By: dean		</title>
		<link>https://gregladen.com/blog/2022/02/26/how-an-epidemic-or-pandemic-starts/#comment-965983</link>

		<dc:creator><![CDATA[dean]]></dc:creator>
		<pubDate>Mon, 28 Feb 2022 13:37:07 +0000</pubDate>
		<guid isPermaLink="false">https://gregladen.com/blog/?p=34342#comment-965983</guid>

					<description><![CDATA[In reply to &lt;a href=&quot;https://gregladen.com/blog/2022/02/26/how-an-epidemic-or-pandemic-starts/#comment-965978&quot;&gt;RickA&lt;/a&gt;.

Tom, rickA is famous for his lies and conspiracy theories, and his total lack of understanding of science. It isn&#039;t that he needs to &quot;keep up&quot;, it&#039;s that he needs to show some sign of wanting to learn and be an honest broker. His history shows he has no such desire.]]></description>
			<content:encoded><![CDATA[<p>In reply to <a href="https://gregladen.com/blog/2022/02/26/how-an-epidemic-or-pandemic-starts/#comment-965978">RickA</a>.</p>
<p>Tom, rickA is famous for his lies and conspiracy theories, and his total lack of understanding of science. It isn&#8217;t that he needs to &#8220;keep up&#8221;, it&#8217;s that he needs to show some sign of wanting to learn and be an honest broker. His history shows he has no such desire.</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		By: Tom Dayton		</title>
		<link>https://gregladen.com/blog/2022/02/26/how-an-epidemic-or-pandemic-starts/#comment-965981</link>

		<dc:creator><![CDATA[Tom Dayton]]></dc:creator>
		<pubDate>Mon, 28 Feb 2022 13:15:11 +0000</pubDate>
		<guid isPermaLink="false">https://gregladen.com/blog/?p=34342#comment-965981</guid>

					<description><![CDATA[In reply to &lt;a href=&quot;https://gregladen.com/blog/2022/02/26/how-an-epidemic-or-pandemic-starts/#comment-965978&quot;&gt;RickA&lt;/a&gt;.

RickA, there is no such sequence. Do try to keep up. https://cn.reuters.com/article/uk-factcheck-hiv-covid-explained-idUSKBN29C26E]]></description>
			<content:encoded><![CDATA[<p>In reply to <a href="https://gregladen.com/blog/2022/02/26/how-an-epidemic-or-pandemic-starts/#comment-965978">RickA</a>.</p>
<p>RickA, there is no such sequence. Do try to keep up. <a href="https://cn.reuters.com/article/uk-factcheck-hiv-covid-explained-idUSKBN29C26E" rel="nofollow ugc">https://cn.reuters.com/article/uk-factcheck-hiv-covid-explained-idUSKBN29C26E</a></p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		By: RickA		</title>
		<link>https://gregladen.com/blog/2022/02/26/how-an-epidemic-or-pandemic-starts/#comment-965978</link>

		<dc:creator><![CDATA[RickA]]></dc:creator>
		<pubDate>Mon, 28 Feb 2022 12:39:00 +0000</pubDate>
		<guid isPermaLink="false">https://gregladen.com/blog/?p=34342#comment-965978</guid>

					<description><![CDATA[What about the patented dna sequence?  One which doesn&#039;t appear in nature but is a sign of human manipulation (patented sequence shows humans invented that portion of the virus).  How does the double natural origin explain that part of the virus?]]></description>
			<content:encoded><![CDATA[<p>What about the patented dna sequence?  One which doesn&#8217;t appear in nature but is a sign of human manipulation (patented sequence shows humans invented that portion of the virus).  How does the double natural origin explain that part of the virus?</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		By: Tom Dayton		</title>
		<link>https://gregladen.com/blog/2022/02/26/how-an-epidemic-or-pandemic-starts/#comment-965747</link>

		<dc:creator><![CDATA[Tom Dayton]]></dc:creator>
		<pubDate>Sun, 27 Feb 2022 02:43:08 +0000</pubDate>
		<guid isPermaLink="false">https://gregladen.com/blog/?p=34342#comment-965747</guid>

					<description><![CDATA[Some less technical and brief explanations are in some videos by a couple of my favorite scientific debunkers. Each video&#039;s textual description below the video has links to the sources of all the claims made in the videos.

Dr. Dan Wilson: 
- video 1: https://youtu.be/qk3eHZLChRE
- video 2: https://youtu.be/fmIo1XFxcEM

potholer54:
- video 1: https://youtu.be/ab-r0capbzk
- video 2: https://youtu.be/aX1EqRuVeU0
- video 3: https://youtu.be/PjafLCvejQA]]></description>
			<content:encoded><![CDATA[<p>Some less technical and brief explanations are in some videos by a couple of my favorite scientific debunkers. Each video&#8217;s textual description below the video has links to the sources of all the claims made in the videos.</p>
<p>Dr. Dan Wilson:<br />
&#8211; video 1: <a href="https://youtu.be/qk3eHZLChRE" rel="nofollow ugc">https://youtu.be/qk3eHZLChRE</a><br />
&#8211; video 2: <a href="https://youtu.be/fmIo1XFxcEM" rel="nofollow ugc">https://youtu.be/fmIo1XFxcEM</a></p>
<p>potholer54:<br />
&#8211; video 1: <a href="https://youtu.be/ab-r0capbzk" rel="nofollow ugc">https://youtu.be/ab-r0capbzk</a><br />
&#8211; video 2: <a href="https://youtu.be/aX1EqRuVeU0" rel="nofollow ugc">https://youtu.be/aX1EqRuVeU0</a><br />
&#8211; video 3: <a href="https://youtu.be/PjafLCvejQA" rel="nofollow ugc">https://youtu.be/PjafLCvejQA</a></p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		By: Greg Laden		</title>
		<link>https://gregladen.com/blog/2022/02/26/how-an-epidemic-or-pandemic-starts/#comment-965730</link>

		<dc:creator><![CDATA[Greg Laden]]></dc:creator>
		<pubDate>Sun, 27 Feb 2022 01:21:04 +0000</pubDate>
		<guid isPermaLink="false">https://gregladen.com/blog/?p=34342#comment-965730</guid>

					<description><![CDATA[In reply to &lt;a href=&quot;https://gregladen.com/blog/2022/02/26/how-an-epidemic-or-pandemic-starts/#comment-965696&quot;&gt;Tom Dayton&lt;/a&gt;.

Yeah, for the lab leak to work it would have to be a very deep conspiracy!]]></description>
			<content:encoded><![CDATA[<p>In reply to <a href="https://gregladen.com/blog/2022/02/26/how-an-epidemic-or-pandemic-starts/#comment-965696">Tom Dayton</a>.</p>
<p>Yeah, for the lab leak to work it would have to be a very deep conspiracy!</p>
]]></content:encoded>
		
			</item>
		<item>
		<title>
		By: Tom Dayton		</title>
		<link>https://gregladen.com/blog/2022/02/26/how-an-epidemic-or-pandemic-starts/#comment-965696</link>

		<dc:creator><![CDATA[Tom Dayton]]></dc:creator>
		<pubDate>Sat, 26 Feb 2022 21:07:09 +0000</pubDate>
		<guid isPermaLink="false">https://gregladen.com/blog/?p=34342#comment-965696</guid>

					<description><![CDATA[Wow, thank you so much for this post, so quickly after those two papers appeared! Yet more, bigger, nails in the coffin of the lab leak speculation!]]></description>
			<content:encoded><![CDATA[<p>Wow, thank you so much for this post, so quickly after those two papers appeared! Yet more, bigger, nails in the coffin of the lab leak speculation!</p>
]]></content:encoded>
		
			</item>
	</channel>
</rss>
