Comments on: Moran, Gregory, Give me a Break!

By: slpage

slpage — Tue, 21 Apr 2009 19:38:35 +0000

Anonymous – I note that you never did reply to Black Cat’s clarification on what you would actually accept as a test of whether ‘junk DNA’ is functionless:So in other words, anonymous, the only evidence that the “junk” is non-functional that you would accept would be to remove all or most of it in a large population and then compare it to a control population over thousands of years? Or am I misunderstanding your criticisms somehow?Perhaps because you realized how silly your position really is?

By: anonymous molecular geneticist

anonymous molecular geneticist — Sun, 20 Jan 2008 12:30:49 +0000

Larry Chasin (Columbia University) has done some interesting work in this regard showing insertion of highly repetitive DNA sequences is an important driver in the evolution of new exons. This work has some extra credibility in terms of the topic of this page because he wasn’t setting out to demonstrate any kind of functionality of highly-repeated genomic elements; that’s just the way the result turned out. (which is to say, he doesn’t have a rhetorical axe to grind here)Comparison of multiple vertebrate genomes reveals the birth and evolution of human exons. Proc Natl Acad Sci U S A. 2006 Sep 5;103(36):13427-32. Epub 2006 Aug 28. Zhang XH, Chasin LA.http://www.pubmedcentral.nih.gov/articlerender.fcgi?pubmedid=16938881His concluding paragraph:This work suggests that highly repeated sequences, rather than being parasitic invaders and junk, play an important evolutionary role in the evolution of new genes. The documentation of a number of Alu exonization events led Sorek et al. [Mol. Cell 14, 221-231 (2004)] to propose that exaptation of Alus may have “promoted speciation of the human lineage.” Our data support this idea and extend it to additional classes of repeats and to other mammals.

By: windy

windy — Sun, 20 Jan 2008 11:40:43 +0000

Just a quick example TAAGATAATGTAGCCCCTGGCCTCAAA part of LINE element, family L2.Definitely junk?It is the lactose tolerance locus on chromosome 2.So what have the Romans done for us apart from the lactose intolerance locus? I could keep on going for days in this manner, suffice to say there are many important regulatory sequences embedded in repeats and simply dismissing them all like Steve and Larry do is simply showing gross ignorance of the field.

Umm, the element in question has acquired the lactase persistence site long after its insertion. This is not evidence that the LINE element itself is doing anything useful. Sort of like saying that we can thank the Romans for pizza.It would have been better to pick an example where the inserted element itself directly affected the regulation of transcription. But even then, it’s not obvious that insertions themselves are on the whole adaptive (let alone the resultant increase in genome size), rather than a source of random mutation that only sometimes has adaptive consequences.

By: Steve LaBonne

Steve LaBonne — Fri, 18 Jan 2008 16:06:15 +0000

Well, that’s a hell of a slippery “argument” with a lot of apples-to-oranges progressions to ever more impressive-sounding numbers. I will readily admit that I have no idea what he’s really trying to say there. But I think genetic load arguments alone already make it very hard to say with a straight face that 20% or even more of the genome may be “functional” in any sense in which that term is normally understood.And I would prefer that people use language with the purpose of being understood rather than with the purpose of making their results sound sexier.

By: Sigmund

Sigmund — Fri, 18 Jan 2008 13:33:21 +0000

Steve, I wouldn’t simply call it semantics. Mattick does explicitly link his definition of functionality with the high level of RNA transcription thoughout the genome. It is probably not the same idea of funtionality that others may have so there is some real possibility for misunderstanding. I wouldn’t go as far as he does in his claims but at least it is a testable hypothesis.Heres the conclusion of the Pheasant and Mattick paper mentioned in the original quote.Pheasant and Mattick 2007 Genome Research”It seems clear that 5% is a minimum estimate of the fractionof the human genome that is functional, and that the true extentis likely to be significantly greater. If the upper figure of 11.8%under common purifying selection in mammals from ENCODE(Margulies et al. 2007) is realistic across the genome as a whole,and if turnover and positive selection approximately doubles thisfigure (Smith et al. 2004), then the functional portion of thegenome may exceed 20%. It is also now clear that the majority ofthe mammalian genome is expressed and that many mammaliangenes are accompanied by extensive regulatory regions. Thus,although admittedly on the basis of as yet limited evidence, it isquite plausible that many, if not the majority, of the expressedtranscripts are functional and that a major component of genomicinformation is rapidly evolving regulatory DNA and RNA.Consequently, it is possible that much if not most of the humangenome may be functional. This possibility cannot be ruled outon the available evidence, either from conservation analysis orfrom genetic studies (Mattick and Makunin 2006), but does challengecurrent conceptions of the extent of functionality of thehuman genome and the nature of the genetic programming ofhumans and other complex organisms.”

By: Greg Laden

Greg Laden — Fri, 18 Jan 2008 12:09:51 +0000

Not to confuse things, but you might have a look here

By: Steve LaBonne

Steve LaBonne — Fri, 18 Jan 2008 11:57:17 +0000

“Paper”, not “appear”, sorry.

By: Steve LaBonne

Steve LaBonne — Fri, 18 Jan 2008 11:56:05 +0000

Now we're into semantics, but I'm not seeing a difference there at all (and the quote from his appear, above, seems quite unambiguous to me). And certainly press coverage of this topic has been interpreting this the same way I do- in a way that's clearly not correct.To use T. R. Gregory's terms, by the way, we may want to say that all that transcriptional activity might have, in bulk, consequences- but that doesn't establish that individual transcripts of "junk" sequences have functions. Unfortunately it sure looks to me like Mattick is pushing the latter view, but I haven't heard him talk.

By: Sigmund

Sigmund — Fri, 18 Jan 2008 11:34:31 +0000

Steve, the problem comes with the interpretation of that phrase. I don’t take it to mean that most of the sequence of the genome is functional, rather that most of the genome contains within it functional sequences, such that you cannot delete large percentages of it without deleterious effects for the reasons I’ve mentioned earlier. I’ve been to meetings when Mattick has been giving talks and I really haven’t got the impression that he is claiming that most of the sequence is functional, rather that most of it is expressed and that this abundance of transcription has a function.

By: Steve LaBonne

Steve LaBonne — Fri, 18 Jan 2008 11:06:14 +0000

What Larry and I were complaining about is Mattick-style sales talk that “much if not most of the genome may be functional”- and as demonstrated above yes he really did say that. I am reading you as agreeing that such statements are bogus, in which case we don’t really disagree.